wave2 rabbit primary antibody Search Results


95
Cell Signaling Technology Inc rabbit anti wave2
Rabbit Anti Wave2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti wave2/product/Cell Signaling Technology Inc
Average 95 stars, based on 1 article reviews
rabbit anti wave2 - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology wave2
Abi1 is found in invadopodia in MDA-MB-231 cells. (A) Expression and complex formation of Abi1 with Sra, Nap1, <t>WAVE2</t> and N-WASP. The MDA-MB-231 cells were lysed and immunoprecipitated (IP) with pre-immune serum (Pre-IP) or anti-Abi1-specific antibodies (Abi1-IP), as indicated. The immunoprecipitates, along with total cell lysate (TCL), were separated on 8% SDS–polyacrylamide gel electrophoresis (PAGE), transferred to nitrocellulose membranes and subjected to western blot (WB) analysis using the indicated antibodies. (B) Abi1 colocalizes with invadopodia. The MDA-MB-231 cells were incubated with anti-Abi1 specific antibody and subsequently stained with Alexa-conjugated secondary antibodies (green). The cells were then counterstained with Alexa-conjugated phalloidin to visualize F-actin (red). Abi1 location in invadopodia is shown by an arrow in the merged image (merge); bar: 10 μm. (C) Abi1 is found in ECM degradation sites. MDA-MB-231 cells were grown on coverslips coated with a thin layer of FITC-conjugated gelatin (green). Cells were incubated with Abi1 antibody and subsequently stained with Alexa-conjugated secondary antibody (red). Degradation is indicated as dark patches within the fluorescent monolayer (upper panel). Abi1 is found in degraded area, as shown by arrows. (D) Expression of GFP and GFP–Abi1 in MDA-MB-231 cells. The MDA-MB-231 cells were transfected with plasmids expressing GFP alone or GFP-tagged Abi1, as indicated. Total cell lysate containing 50 μg protein was separated on SDS–PAGE and analyzed by western blot using indicated antibodies. (E) GFP–Abi1 is found in invadopodia-like structures. The MDA-MB-231 cells expressing GFP–Abi1 were counterstained with Alexa-conjugated phalloidin (red). The subcellular localization of GFP–Abi1 and F-actin was examined by fluorescence microscopy. GFP–Abi1 was found in F-actin-enriched puncta, as indicated by arrow. (F) F-actin-enriched puncta colocalize with ECM degradation sites. MDA-MB-231 cells were grown on coverslips coated with a thin layer of FITC-conjugated gelatin (green). Cells were stained with Alexa-conjugated phalloidin (red) and examined by fluorescence microscopy. Degradation is indicated as dark patches within the fluorescent monolayer. The F-actin-enriched puncta locate in the degraded area, as indicated by arrows; bar: 10 μm. (G) GFP–Abi1 colocalizes with cortactin. The MDA-MB-231 cells expressing GFP–Abi1 were incubated with anti-cortactin-specific antibody and subsequently stained with Alexa-conjugated secondary antibodies (red). The subcellular localization of GFP–Abi1 and cortactin was examined by fluorescence microscopy. The colocalization of Abi1 with cortactin is shown by the merged image (merge). The arrows indicate Abi1, invadopodia and their colocalization; bar: 10 μm.
Wave2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/wave2/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
wave2 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
Millipore wave2 3 † aucagggugaggugggaaagauggg uagucccacuccacccuuucuaccc
Small interference RNA (siRNA) and antibodies used in RNA interference experiments in the present study
Wave2 3 † Aucagggugaggugggaaagauggg Uagucccacuccacccuuucuaccc, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/wave2 3 † aucagggugaggugggaaagauggg uagucccacuccacccuuucuaccc/product/Millipore
Average 90 stars, based on 1 article reviews
wave2 3 † aucagggugaggugggaaagauggg uagucccacuccacccuuucuaccc - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

94
Cell Signaling Technology Inc wave2 antibody
Small interference RNA (siRNA) and antibodies used in RNA interference experiments in the present study
Wave2 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/wave2 antibody/product/Cell Signaling Technology Inc
Average 94 stars, based on 1 article reviews
wave2 antibody - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

90
Santa Cruz Biotechnology rabbit polyclonal anti-wave2 antibody (cat#: 3659)
Effects of SKAP2 RNAi on ARP2 and <t>WAVE2</t> expression. (A) Subcellular localization of ARP2 after SKAP2 siRNA injection. ARP2 was mainly distributed at the membrane in the control oocytes, whereas ARP2 expression was barely detectable in the siRNA-injected group. Green: ARP2; blue: chromatin. Bar = 20 μm. (B) Localization of WAVE2 after SKAP2 siRNA injection. WAVE2 was expressed around the spindle, whereas no specific localization of WAVE2 was observed around spindle in the siRNA-injected group. Red: WAVE2; blue: chromatin. Bar = 20 μm. (C) The fluorescence intensity of ARP2 in the SKAP2 siRNA-injected oocytes was decreased. (D) The fluorescence intensity of WAVE2 in SKAP2 siRNA-injected oocytes was significantly reduced. (E) ARP2 expression was reduced after SKAP2 siRNA injection by western blotting examination, as the relative intensity of ARP2 protein was significantly decreased. (F) WAVE2 expression was decreased after SKAP2 siRNA injection by western blotting analysis, as the relative intensity of WAVE2 protein was significantly reduced. *: significant difference (P < 0.05).
Rabbit Polyclonal Anti Wave2 Antibody (Cat#: 3659), supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit polyclonal anti-wave2 antibody (cat#: 3659)/product/Santa Cruz Biotechnology
Average 90 stars, based on 1 article reviews
rabbit polyclonal anti-wave2 antibody (cat#: 3659) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

92
Cell Signaling Technology Inc wave2 d2c8 antibodies
( A ) TCR-induced recruitment of NWASP and <t>WAVE2</t> to IS. Mouse primary WT CD4 T cells were incubated with bilayer containing ICAM1 alone (−) or both ICAM1 and anti-CD3 (+) for 2 min at 37°C, fixed and immunostained for endogenous proteins. Stained cells were visualized using TIRF microscopy. The graph shows quantitation of antibody fluorescence at IS, where each point represents the value obtained from a single cell. n1 = 16, n2 = 54 (for WAVE2), n3 = 16, n4 = 78 (for NWASP); p1, p2 < 0.0001 . Each point represents average levels of indicated protein at synapse in a single cell. ( B ) The images shown are TIRF plane distributions of the indicated proteins. As elaborated in the magnified areas marked with white boundary in original ‘merge’ image, there is a lack of co-localization between either of these proteins and TCR MCs. Scale bar, 5 μm. Insets in ( B ) have been intensity scaled differently from original ‘Merge’ panel to highlight protein distribution with more clarity. DOI: http://dx.doi.org/10.7554/eLife.04953.007
Wave2 D2c8 Antibodies, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/wave2 d2c8 antibodies/product/Cell Signaling Technology Inc
Average 92 stars, based on 1 article reviews
wave2 d2c8 antibodies - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology goat anti wave2 polyclonal antibody
FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and <t>WAVE2</t> by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.
Goat Anti Wave2 Polyclonal Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/goat anti wave2 polyclonal antibody/product/Santa Cruz Biotechnology
Average 96 stars, based on 1 article reviews
goat anti wave2 polyclonal antibody - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

95
Cell Signaling Technology Inc 2004 2236 1 wave3 rabbit igg
FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and <t>WAVE2</t> by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.
2004 2236 1 Wave3 Rabbit Igg, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/2004 2236 1 wave3 rabbit igg/product/Cell Signaling Technology Inc
Average 95 stars, based on 1 article reviews
2004 2236 1 wave3 rabbit igg - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

95
Proteintech anti wave 2
FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and <t>WAVE2</t> by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.
Anti Wave 2, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti wave 2/product/Proteintech
Average 95 stars, based on 1 article reviews
anti wave 2 - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

90
Cell Signaling Technology Inc anti-βactin
FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and <t>WAVE2</t> by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.
Anti βactin, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-βactin/product/Cell Signaling Technology Inc
Average 90 stars, based on 1 article reviews
anti-βactin - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

99
Cell Signaling Technology Inc wave 2 d2c8 xp rabbit mab
FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and <t>WAVE2</t> by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.
Wave 2 D2c8 Xp Rabbit Mab, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/wave 2 d2c8 xp rabbit mab/product/Cell Signaling Technology Inc
Average 99 stars, based on 1 article reviews
wave 2 d2c8 xp rabbit mab - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

90
Abbkine Inc anti-wave2

Anti Wave2, supplied by Abbkine Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-wave2/product/Abbkine Inc
Average 90 stars, based on 1 article reviews
anti-wave2 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


Abi1 is found in invadopodia in MDA-MB-231 cells. (A) Expression and complex formation of Abi1 with Sra, Nap1, WAVE2 and N-WASP. The MDA-MB-231 cells were lysed and immunoprecipitated (IP) with pre-immune serum (Pre-IP) or anti-Abi1-specific antibodies (Abi1-IP), as indicated. The immunoprecipitates, along with total cell lysate (TCL), were separated on 8% SDS–polyacrylamide gel electrophoresis (PAGE), transferred to nitrocellulose membranes and subjected to western blot (WB) analysis using the indicated antibodies. (B) Abi1 colocalizes with invadopodia. The MDA-MB-231 cells were incubated with anti-Abi1 specific antibody and subsequently stained with Alexa-conjugated secondary antibodies (green). The cells were then counterstained with Alexa-conjugated phalloidin to visualize F-actin (red). Abi1 location in invadopodia is shown by an arrow in the merged image (merge); bar: 10 μm. (C) Abi1 is found in ECM degradation sites. MDA-MB-231 cells were grown on coverslips coated with a thin layer of FITC-conjugated gelatin (green). Cells were incubated with Abi1 antibody and subsequently stained with Alexa-conjugated secondary antibody (red). Degradation is indicated as dark patches within the fluorescent monolayer (upper panel). Abi1 is found in degraded area, as shown by arrows. (D) Expression of GFP and GFP–Abi1 in MDA-MB-231 cells. The MDA-MB-231 cells were transfected with plasmids expressing GFP alone or GFP-tagged Abi1, as indicated. Total cell lysate containing 50 μg protein was separated on SDS–PAGE and analyzed by western blot using indicated antibodies. (E) GFP–Abi1 is found in invadopodia-like structures. The MDA-MB-231 cells expressing GFP–Abi1 were counterstained with Alexa-conjugated phalloidin (red). The subcellular localization of GFP–Abi1 and F-actin was examined by fluorescence microscopy. GFP–Abi1 was found in F-actin-enriched puncta, as indicated by arrow. (F) F-actin-enriched puncta colocalize with ECM degradation sites. MDA-MB-231 cells were grown on coverslips coated with a thin layer of FITC-conjugated gelatin (green). Cells were stained with Alexa-conjugated phalloidin (red) and examined by fluorescence microscopy. Degradation is indicated as dark patches within the fluorescent monolayer. The F-actin-enriched puncta locate in the degraded area, as indicated by arrows; bar: 10 μm. (G) GFP–Abi1 colocalizes with cortactin. The MDA-MB-231 cells expressing GFP–Abi1 were incubated with anti-cortactin-specific antibody and subsequently stained with Alexa-conjugated secondary antibodies (red). The subcellular localization of GFP–Abi1 and cortactin was examined by fluorescence microscopy. The colocalization of Abi1 with cortactin is shown by the merged image (merge). The arrows indicate Abi1, invadopodia and their colocalization; bar: 10 μm.

Journal: Carcinogenesis

Article Title: Abl interactor 1 regulates Src-Id1-matrix metalloproteinase 9 axis and is required for invadopodia formation, extracellular matrix degradation and tumor growth of human breast cancer cells

doi: 10.1093/carcin/bgp251

Figure Lengend Snippet: Abi1 is found in invadopodia in MDA-MB-231 cells. (A) Expression and complex formation of Abi1 with Sra, Nap1, WAVE2 and N-WASP. The MDA-MB-231 cells were lysed and immunoprecipitated (IP) with pre-immune serum (Pre-IP) or anti-Abi1-specific antibodies (Abi1-IP), as indicated. The immunoprecipitates, along with total cell lysate (TCL), were separated on 8% SDS–polyacrylamide gel electrophoresis (PAGE), transferred to nitrocellulose membranes and subjected to western blot (WB) analysis using the indicated antibodies. (B) Abi1 colocalizes with invadopodia. The MDA-MB-231 cells were incubated with anti-Abi1 specific antibody and subsequently stained with Alexa-conjugated secondary antibodies (green). The cells were then counterstained with Alexa-conjugated phalloidin to visualize F-actin (red). Abi1 location in invadopodia is shown by an arrow in the merged image (merge); bar: 10 μm. (C) Abi1 is found in ECM degradation sites. MDA-MB-231 cells were grown on coverslips coated with a thin layer of FITC-conjugated gelatin (green). Cells were incubated with Abi1 antibody and subsequently stained with Alexa-conjugated secondary antibody (red). Degradation is indicated as dark patches within the fluorescent monolayer (upper panel). Abi1 is found in degraded area, as shown by arrows. (D) Expression of GFP and GFP–Abi1 in MDA-MB-231 cells. The MDA-MB-231 cells were transfected with plasmids expressing GFP alone or GFP-tagged Abi1, as indicated. Total cell lysate containing 50 μg protein was separated on SDS–PAGE and analyzed by western blot using indicated antibodies. (E) GFP–Abi1 is found in invadopodia-like structures. The MDA-MB-231 cells expressing GFP–Abi1 were counterstained with Alexa-conjugated phalloidin (red). The subcellular localization of GFP–Abi1 and F-actin was examined by fluorescence microscopy. GFP–Abi1 was found in F-actin-enriched puncta, as indicated by arrow. (F) F-actin-enriched puncta colocalize with ECM degradation sites. MDA-MB-231 cells were grown on coverslips coated with a thin layer of FITC-conjugated gelatin (green). Cells were stained with Alexa-conjugated phalloidin (red) and examined by fluorescence microscopy. Degradation is indicated as dark patches within the fluorescent monolayer. The F-actin-enriched puncta locate in the degraded area, as indicated by arrows; bar: 10 μm. (G) GFP–Abi1 colocalizes with cortactin. The MDA-MB-231 cells expressing GFP–Abi1 were incubated with anti-cortactin-specific antibody and subsequently stained with Alexa-conjugated secondary antibodies (red). The subcellular localization of GFP–Abi1 and cortactin was examined by fluorescence microscopy. The colocalization of Abi1 with cortactin is shown by the merged image (merge). The arrows indicate Abi1, invadopodia and their colocalization; bar: 10 μm.

Article Snippet: The polyclonal antibodies against N-WASP, WAVE2 and c-Src were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

Techniques: Expressing, Immunoprecipitation, Polyacrylamide Gel Electrophoresis, Western Blot, Incubation, Staining, Transfection, SDS Page, Fluorescence, Microscopy

Small interference RNA (siRNA) and antibodies used in RNA interference experiments in the present study

Journal: Cancer Science

Article Title: WAVE2‐ and microtubule‐dependent formation of long protrusions and invasion of cancer cells cultured on three‐dimensional extracellular matrices

doi: 10.1111/j.1349-7006.2008.00927.x

Figure Lengend Snippet: Small interference RNA (siRNA) and antibodies used in RNA interference experiments in the present study

Article Snippet: Table 1 Target siRNA Antibody for detection of protein N‐WASP GAAAUGUGUGACUAUGUCUTT TTCUUUACACACUGAUACAGA Cell signaling, rabbit MAb (30D10) WAVE1 UCCUUCGUAUUUCUUUGAUTT TTAGGAAGCAUAAAGAAACUA Santa Cruz, goat pAb (L‐19) WAVE2‐1 † AAACCAGAUCCUCUUUGGUUGUCCA UUUGGUCUAGGAGAAACCAACAGGU Chemicon, rabbit pAb (AB4226) WAVE3 CUUCUACAUCAGAGCAAAUTT TTGAAGAUGUAGUCUCGUUUA Santa Cruz, goat pAb (N‐16) WAVE2‐2 † UAUCAUUGGAGGCGGAGGUGGCGGA AUAGUAACCUCCGCCUCCACCGCCU Chemicon, rabbit pAb (AB4226) WAVE2‐3 † AUCAGGGUGAGGUGGGAAAGAUGGG UAGUCCCACUCCACCCUUUCUACCC Chemicon, rabbit pAb (AB4226) Control GACGUGAAACCGAAGAACGTT TTCUGCAGUUUGGCUUCUUGC Open in a separate window † Invitrogen stealth siRNA.

Techniques:

(a–c) Reduction of neural Wiskott–Aldrich Syndrome protein (N‐WASP) or WASP family Verprolin‐homologous protein (WAVE) family proteins by RNA interference in MDA‐MB‐231 cells. Cells were transfected with small interference RNA (siRNA) for 24 h and further cultured for 24 h, then part of the cells was used to extraction of proteins and the rest were plated on 3‐D gel. Western blot analyzes of N‐WASP (a), WAVE family proteins (b) and WAVE2 (c) expression. (d and e) Effect of siRNA on the formation of long protrusions and invasion. Cells transfected with siRNA were cultured on 3‐D gel for 18 h. Results of cells transfected with specific siRNA are normalized to those of cells treated with control siRNA as 100 in each experiment. Averages of the results of repeated experiments (N: number of experiments) are shown with standard deviations (error bars). Asterisks mark the results with P‐values of Student's t‐test less than 0.05. (f) Effect of siRNA on the formation of invadopodia. Cells transfected with siRNA for 48 h were plated onto Oregon Green 488 conjugated‐gelatin film and cultured for 18 h. The cells with one or more sites in which focally degraded‐gelatin and a punctate aggregate of F‐actin were judged to form invadopodia. Averages of the results of four independent experiments are shown with standard deviations (error bars). P‐values of Student's t‐test for the difference between the results with control siRNA and either N‐WASP or WAVE2 siRNA are noted in the figure. Those with control siRNA and siRNA for WAVE1 or WAVE3 exceeded 0.1.

Journal: Cancer Science

Article Title: WAVE2‐ and microtubule‐dependent formation of long protrusions and invasion of cancer cells cultured on three‐dimensional extracellular matrices

doi: 10.1111/j.1349-7006.2008.00927.x

Figure Lengend Snippet: (a–c) Reduction of neural Wiskott–Aldrich Syndrome protein (N‐WASP) or WASP family Verprolin‐homologous protein (WAVE) family proteins by RNA interference in MDA‐MB‐231 cells. Cells were transfected with small interference RNA (siRNA) for 24 h and further cultured for 24 h, then part of the cells was used to extraction of proteins and the rest were plated on 3‐D gel. Western blot analyzes of N‐WASP (a), WAVE family proteins (b) and WAVE2 (c) expression. (d and e) Effect of siRNA on the formation of long protrusions and invasion. Cells transfected with siRNA were cultured on 3‐D gel for 18 h. Results of cells transfected with specific siRNA are normalized to those of cells treated with control siRNA as 100 in each experiment. Averages of the results of repeated experiments (N: number of experiments) are shown with standard deviations (error bars). Asterisks mark the results with P‐values of Student's t‐test less than 0.05. (f) Effect of siRNA on the formation of invadopodia. Cells transfected with siRNA for 48 h were plated onto Oregon Green 488 conjugated‐gelatin film and cultured for 18 h. The cells with one or more sites in which focally degraded‐gelatin and a punctate aggregate of F‐actin were judged to form invadopodia. Averages of the results of four independent experiments are shown with standard deviations (error bars). P‐values of Student's t‐test for the difference between the results with control siRNA and either N‐WASP or WAVE2 siRNA are noted in the figure. Those with control siRNA and siRNA for WAVE1 or WAVE3 exceeded 0.1.

Article Snippet: Table 1 Target siRNA Antibody for detection of protein N‐WASP GAAAUGUGUGACUAUGUCUTT TTCUUUACACACUGAUACAGA Cell signaling, rabbit MAb (30D10) WAVE1 UCCUUCGUAUUUCUUUGAUTT TTAGGAAGCAUAAAGAAACUA Santa Cruz, goat pAb (L‐19) WAVE2‐1 † AAACCAGAUCCUCUUUGGUUGUCCA UUUGGUCUAGGAGAAACCAACAGGU Chemicon, rabbit pAb (AB4226) WAVE3 CUUCUACAUCAGAGCAAAUTT TTGAAGAUGUAGUCUCGUUUA Santa Cruz, goat pAb (N‐16) WAVE2‐2 † UAUCAUUGGAGGCGGAGGUGGCGGA AUAGUAACCUCCGCCUCCACCGCCU Chemicon, rabbit pAb (AB4226) WAVE2‐3 † AUCAGGGUGAGGUGGGAAAGAUGGG UAGUCCCACUCCACCCUUUCUACCC Chemicon, rabbit pAb (AB4226) Control GACGUGAAACCGAAGAACGTT TTCUGCAGUUUGGCUUCUUGC Open in a separate window † Invitrogen stealth siRNA.

Techniques: Transfection, Cell Culture, Extraction, Western Blot, Expressing

Effects of SKAP2 RNAi on ARP2 and WAVE2 expression. (A) Subcellular localization of ARP2 after SKAP2 siRNA injection. ARP2 was mainly distributed at the membrane in the control oocytes, whereas ARP2 expression was barely detectable in the siRNA-injected group. Green: ARP2; blue: chromatin. Bar = 20 μm. (B) Localization of WAVE2 after SKAP2 siRNA injection. WAVE2 was expressed around the spindle, whereas no specific localization of WAVE2 was observed around spindle in the siRNA-injected group. Red: WAVE2; blue: chromatin. Bar = 20 μm. (C) The fluorescence intensity of ARP2 in the SKAP2 siRNA-injected oocytes was decreased. (D) The fluorescence intensity of WAVE2 in SKAP2 siRNA-injected oocytes was significantly reduced. (E) ARP2 expression was reduced after SKAP2 siRNA injection by western blotting examination, as the relative intensity of ARP2 protein was significantly decreased. (F) WAVE2 expression was decreased after SKAP2 siRNA injection by western blotting analysis, as the relative intensity of WAVE2 protein was significantly reduced. *: significant difference (P < 0.05).

Journal: Cell Cycle

Article Title: SKAP2 regulates Arp2/3 complex for actin-mediated asymmetric cytokinesis by interacting with WAVE2 in mouse oocytes

doi: 10.1080/15384101.2017.1380126

Figure Lengend Snippet: Effects of SKAP2 RNAi on ARP2 and WAVE2 expression. (A) Subcellular localization of ARP2 after SKAP2 siRNA injection. ARP2 was mainly distributed at the membrane in the control oocytes, whereas ARP2 expression was barely detectable in the siRNA-injected group. Green: ARP2; blue: chromatin. Bar = 20 μm. (B) Localization of WAVE2 after SKAP2 siRNA injection. WAVE2 was expressed around the spindle, whereas no specific localization of WAVE2 was observed around spindle in the siRNA-injected group. Red: WAVE2; blue: chromatin. Bar = 20 μm. (C) The fluorescence intensity of ARP2 in the SKAP2 siRNA-injected oocytes was decreased. (D) The fluorescence intensity of WAVE2 in SKAP2 siRNA-injected oocytes was significantly reduced. (E) ARP2 expression was reduced after SKAP2 siRNA injection by western blotting examination, as the relative intensity of ARP2 protein was significantly decreased. (F) WAVE2 expression was decreased after SKAP2 siRNA injection by western blotting analysis, as the relative intensity of WAVE2 protein was significantly reduced. *: significant difference (P < 0.05).

Article Snippet: Rabbit polyclonal anti-WAVE2 antibody (Cat#: 3659) was from Santa Cruz (Santa Cruz, CA, USA).

Techniques: Expressing, Injection, Fluorescence, Western Blot

( A ) TCR-induced recruitment of NWASP and WAVE2 to IS. Mouse primary WT CD4 T cells were incubated with bilayer containing ICAM1 alone (−) or both ICAM1 and anti-CD3 (+) for 2 min at 37°C, fixed and immunostained for endogenous proteins. Stained cells were visualized using TIRF microscopy. The graph shows quantitation of antibody fluorescence at IS, where each point represents the value obtained from a single cell. n1 = 16, n2 = 54 (for WAVE2), n3 = 16, n4 = 78 (for NWASP); p1, p2 < 0.0001 . Each point represents average levels of indicated protein at synapse in a single cell. ( B ) The images shown are TIRF plane distributions of the indicated proteins. As elaborated in the magnified areas marked with white boundary in original ‘merge’ image, there is a lack of co-localization between either of these proteins and TCR MCs. Scale bar, 5 μm. Insets in ( B ) have been intensity scaled differently from original ‘Merge’ panel to highlight protein distribution with more clarity. DOI: http://dx.doi.org/10.7554/eLife.04953.007

Journal: eLife

Article Title: Actin foci facilitate activation of the phospholipase C-γ in primary T lymphocytes via the WASP pathway

doi: 10.7554/eLife.04953

Figure Lengend Snippet: ( A ) TCR-induced recruitment of NWASP and WAVE2 to IS. Mouse primary WT CD4 T cells were incubated with bilayer containing ICAM1 alone (−) or both ICAM1 and anti-CD3 (+) for 2 min at 37°C, fixed and immunostained for endogenous proteins. Stained cells were visualized using TIRF microscopy. The graph shows quantitation of antibody fluorescence at IS, where each point represents the value obtained from a single cell. n1 = 16, n2 = 54 (for WAVE2), n3 = 16, n4 = 78 (for NWASP); p1, p2 < 0.0001 . Each point represents average levels of indicated protein at synapse in a single cell. ( B ) The images shown are TIRF plane distributions of the indicated proteins. As elaborated in the magnified areas marked with white boundary in original ‘merge’ image, there is a lack of co-localization between either of these proteins and TCR MCs. Scale bar, 5 μm. Insets in ( B ) have been intensity scaled differently from original ‘Merge’ panel to highlight protein distribution with more clarity. DOI: http://dx.doi.org/10.7554/eLife.04953.007

Article Snippet: HS1 antibody (D5A9), Phospho-Y397 HS-1 antibody (D12C1), phospho-Y319 Zap70/Y352 Syk (affinity purified antisera #2704), PLCγ1 (D9H10), phospho-Y783 PLCγ1 (#2821), NFAT1 (D43B1), phospho-Y416 SFK (#6943), phospho-Y171 LAT (#3581) and WAVE2 (D2C8) antibodies were obtained from Cell Signaling Technology (Beverly, MA).

Techniques: Incubation, Staining, Microscopy, Quantitation Assay, Fluorescence

Human CD4 T cells were incubated with culture media containing lentiviral particles carrying WASP shRNA or non-specific (control) shRNA for 48 hr ( A ) T cells transduced with WASP shRNA or control shRNA carrying lentiviral particles were incubated with endothelial monolayer for 10 min, fixed and processed for Alexa594-phalloidin (pseudo-colored green) and phospho-HS1 (pseudo-colored red) immuno-staining. The conjugates were then imaged using an EMCCD-coupled spinning disc confocal microscope. Each image represents a single confocal plane of T cell synapse, where the planar endothelial interface is in focus. The area outlined in ‘merge’ panels was further scaled and magnified to show the details with more clarity (bottom panels). The top panels show the image of the field of view in DIC (left image) or fluorescence settings. ( B ) A reduction in WASP levels results in defective phospho-HS1 accumulation at T cell-endothelial cell synapse. The upper graph shows quantitation of phalloidin intensity in the synaptic plane, while the lower graph shows phospho-HS1 levels in the same plane. For both the upper and lower graphs, n1 = 68, n2 = 29, p1 = 0.071, p2 < 0.0001 . This experiment was repeated twice with similar results. ( C ) Model of temporal sequence of events leading to F-actin foci formation and PLCγ signaling at the immunological synapse. Multiple pathways can result in actin polymerization and remodeling at the synaptic interface, contributing to F-actin organization in different SMAC zones. One such pathway involves WAVE2 recruitment by activated LFA1, followed by WAVE2 dependent Arp2/3 complex activation resulting in thick lamellipodial (dSMAC) and lamellar (pSMAC) F-actin meshworks. WAVE2-dependent F-actin pool is required for calcium-dependent calcium entry via the CRAC channel. Additional pathways including MyosinII-mediated actin remodeling is required for maintaining lamellar actin flow and directional persistence of microclusters (MCs) towards the cSMAC, and formin-mediated nucleation of F-actin promotes MTOC docking and stability of synapse. Another pool of F-actin or ‘F-actin foci’ is generated by the activity of WASP protein in the p- and dSMAC zones. Following TCR triggering, WASP is recruited at TCR signalosome via several possible mechanisms – such as via Vav, via NCK, via Zap70 and CrkL mediated WIP release and other effector mechanisms, and, through Fyn or PIP2 or PTP-PEST-binding at the plasma membrane (PM). Once activated, WASP recruits Arp2/3 complex to the MC, which then leads to actin branch nucleation and polymerization at the MC, over and above the local background actin. This process continues even during MC movement in the lamellar region, with a high F-actin turnover at the foci until its delivery to the cSMAC. In the foci, HS1 is recruited via binding both the Arp2/3 complex as well as F-actin, and is subsequently phosphorylated. As a consequence of early TCR signaling, PLCγ1 is also recruited to the MC signalosome, where it is stabilized via interactions with both F-actin, and foci residing HS1. F-actin foci dynamics in the proximity of the plasma membrane further support PLCγ1 phosphorylation, potentially by facilitating its interaction with PM-bound, upstream activators such as Itk. Phosphorylation of PLCγ1 by Itk then triggers phosphoinositide signaling, which in turn initiates calcium ion flux and NFAT1 activation. WASP deficiency or failure to activate Arp2/3 complex by WASPΔC mutant leads to selective loss of nucleation of foci at the MC. As a result, early signaling is not affected, however, both HS1 and PLCγ1 levels are severely reduced at the microcluster sites. The remaining PLCγ1 at synapse allows cell spreading and synapse formation, however, it is not sufficient to achieve calcium flux comparable to the control cells. Direct pharmacological inhibition of Arp2/3 complex using CK666 yields similar results; early TCR signaling is preserved while PLCγ1 phosphorylation and late signaling are severely perturbed. As actin polymerizing processes other than WASP also utilize Arp2/3 Complex, CK666-treated cells show a general reduction in lamellipodial and lamellar actin as well. However, the remaining F-actin levels are sufficient to support early TCR signaling. In contrast, total F-actin depolymerization at the synapse using CytochalasinD results in defects in early as well as late signaling, as has been reported in earlier studies. The image on the bottom shows a maximum intensity projection of synaptic contact interface of a human primary CD4 T cell, acquired using spinning disc confocal microscope. This cell was activated on a bilayer reconstituted with Alexa568 tagged anti-CD3 (red) and ICAM1 (unlabeled), for 2 min, fixed and stained for F-actin (green), and imaged. DOI: http://dx.doi.org/10.7554/eLife.04953.031

Journal: eLife

Article Title: Actin foci facilitate activation of the phospholipase C-γ in primary T lymphocytes via the WASP pathway

doi: 10.7554/eLife.04953

Figure Lengend Snippet: Human CD4 T cells were incubated with culture media containing lentiviral particles carrying WASP shRNA or non-specific (control) shRNA for 48 hr ( A ) T cells transduced with WASP shRNA or control shRNA carrying lentiviral particles were incubated with endothelial monolayer for 10 min, fixed and processed for Alexa594-phalloidin (pseudo-colored green) and phospho-HS1 (pseudo-colored red) immuno-staining. The conjugates were then imaged using an EMCCD-coupled spinning disc confocal microscope. Each image represents a single confocal plane of T cell synapse, where the planar endothelial interface is in focus. The area outlined in ‘merge’ panels was further scaled and magnified to show the details with more clarity (bottom panels). The top panels show the image of the field of view in DIC (left image) or fluorescence settings. ( B ) A reduction in WASP levels results in defective phospho-HS1 accumulation at T cell-endothelial cell synapse. The upper graph shows quantitation of phalloidin intensity in the synaptic plane, while the lower graph shows phospho-HS1 levels in the same plane. For both the upper and lower graphs, n1 = 68, n2 = 29, p1 = 0.071, p2 < 0.0001 . This experiment was repeated twice with similar results. ( C ) Model of temporal sequence of events leading to F-actin foci formation and PLCγ signaling at the immunological synapse. Multiple pathways can result in actin polymerization and remodeling at the synaptic interface, contributing to F-actin organization in different SMAC zones. One such pathway involves WAVE2 recruitment by activated LFA1, followed by WAVE2 dependent Arp2/3 complex activation resulting in thick lamellipodial (dSMAC) and lamellar (pSMAC) F-actin meshworks. WAVE2-dependent F-actin pool is required for calcium-dependent calcium entry via the CRAC channel. Additional pathways including MyosinII-mediated actin remodeling is required for maintaining lamellar actin flow and directional persistence of microclusters (MCs) towards the cSMAC, and formin-mediated nucleation of F-actin promotes MTOC docking and stability of synapse. Another pool of F-actin or ‘F-actin foci’ is generated by the activity of WASP protein in the p- and dSMAC zones. Following TCR triggering, WASP is recruited at TCR signalosome via several possible mechanisms – such as via Vav, via NCK, via Zap70 and CrkL mediated WIP release and other effector mechanisms, and, through Fyn or PIP2 or PTP-PEST-binding at the plasma membrane (PM). Once activated, WASP recruits Arp2/3 complex to the MC, which then leads to actin branch nucleation and polymerization at the MC, over and above the local background actin. This process continues even during MC movement in the lamellar region, with a high F-actin turnover at the foci until its delivery to the cSMAC. In the foci, HS1 is recruited via binding both the Arp2/3 complex as well as F-actin, and is subsequently phosphorylated. As a consequence of early TCR signaling, PLCγ1 is also recruited to the MC signalosome, where it is stabilized via interactions with both F-actin, and foci residing HS1. F-actin foci dynamics in the proximity of the plasma membrane further support PLCγ1 phosphorylation, potentially by facilitating its interaction with PM-bound, upstream activators such as Itk. Phosphorylation of PLCγ1 by Itk then triggers phosphoinositide signaling, which in turn initiates calcium ion flux and NFAT1 activation. WASP deficiency or failure to activate Arp2/3 complex by WASPΔC mutant leads to selective loss of nucleation of foci at the MC. As a result, early signaling is not affected, however, both HS1 and PLCγ1 levels are severely reduced at the microcluster sites. The remaining PLCγ1 at synapse allows cell spreading and synapse formation, however, it is not sufficient to achieve calcium flux comparable to the control cells. Direct pharmacological inhibition of Arp2/3 complex using CK666 yields similar results; early TCR signaling is preserved while PLCγ1 phosphorylation and late signaling are severely perturbed. As actin polymerizing processes other than WASP also utilize Arp2/3 Complex, CK666-treated cells show a general reduction in lamellipodial and lamellar actin as well. However, the remaining F-actin levels are sufficient to support early TCR signaling. In contrast, total F-actin depolymerization at the synapse using CytochalasinD results in defects in early as well as late signaling, as has been reported in earlier studies. The image on the bottom shows a maximum intensity projection of synaptic contact interface of a human primary CD4 T cell, acquired using spinning disc confocal microscope. This cell was activated on a bilayer reconstituted with Alexa568 tagged anti-CD3 (red) and ICAM1 (unlabeled), for 2 min, fixed and stained for F-actin (green), and imaged. DOI: http://dx.doi.org/10.7554/eLife.04953.031

Article Snippet: HS1 antibody (D5A9), Phospho-Y397 HS-1 antibody (D12C1), phospho-Y319 Zap70/Y352 Syk (affinity purified antisera #2704), PLCγ1 (D9H10), phospho-Y783 PLCγ1 (#2821), NFAT1 (D43B1), phospho-Y416 SFK (#6943), phospho-Y171 LAT (#3581) and WAVE2 (D2C8) antibodies were obtained from Cell Signaling Technology (Beverly, MA).

Techniques: Incubation, shRNA, Control, Transduction, Immunostaining, Microscopy, Fluorescence, Quantitation Assay, Sequencing, Activation Assay, Generated, Activity Assay, Binding Assay, Clinical Proteomics, Membrane, Phospho-proteomics, Mutagenesis, Inhibition, Staining

FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and WAVE2 by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.

Journal: Journal of Biological Chemistry

Article Title: Dysbindin-1C Is Required for the Survival of Hilar Mossy Cells and the Maturation of Adult Newborn Neurons in Dentate Gyrus

doi: 10.1074/jbc.m114.590927

Figure Lengend Snippet: FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and WAVE2 by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.

Article Snippet: Other antibodies used in this study were as follows: goat anti-WAVE2 polyclonal antibody (WB, 1:1000, sc-10394, Santa Cruz Biotechnology, Dallas, TX); goat anti- - dystrobrevin polyclonal antibody (WB, 1:200, sc-13815, Santa Cruz Biotechnology); mouse anti- -actin monoclonal antibody (WB, 1:10,000, A5441, Sigma); goat anti-Sox2 polyclonal antibody (IF, 1:1000, sc-17320, Santa Cruz Biotechnology); mouse anti-nestin monoclonal antibody (IF, 1:100, MAB353, Millipore, Billerica, MA); mouse anti-GFAP monoclonal antibody (IF, 1:1000, IF03L, Millipore); mouse anti-GAD67 monoclonal antibody (IF, 1:100, MAB5406, Millipore); mouse anti-calretinin monoclonal antibody (IF, 1:1000, MAB1568, Millipore); rat anti-BrdU monoclonal antibody (IF, 1:100, ab6326, Abcam, Cambridge, UK); goat anti-DCX polyclonal antibody (IF, 1:150, sc-8066, Santa Cruz Biotechnology); mouse anti-NeuN monoclonal antibody (IF, 1:800, MAB377, Millipore); rabbit antiS100 polyclonal antibody (IF, 1:1000, ab868, Abcam); rabbit anti-phospho-CREB (Ser133) polyclonal antibody (IF, 1:200, 9198, Cell Signaling Technology, Danvers, MA), monoclonal mouse anti-Flag antibody (WB, 1:5000, Sigma); and secondary antibody Alexa Fluor 408, 488, or 594 IgG (1:2000, Molecular Probes, Eugene, OR).

Techniques: Expressing, SDS Page, Western Blot, Negative Control, Control, Membrane, Fractionation, Marker, Sedimentation, Mutagenesis

Journal: iScience

Article Title: WASH interacts with Ku to regulate DNA double-stranded break repair

doi: 10.1016/j.isci.2021.103676

Figure Lengend Snippet:

Article Snippet: Rabbit polyclonal anti-WAVE2 , Abbkine , Cat#ABP53432.

Techniques: Recombinant, In Situ, Plasmid Preparation, Expressing, Construct, Software